Worm Strain: RG3123
Allele Name: veDf1
Gene: his-55, his-56, his-58, his-57
Parent Strain: N2
Phenotype: Homozygous viable

Genotype: veDf1 IV.

Description: Homozygous viable. Deficiency of 4040 bp, removes his-55, his-56, his-58 and his-57, with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaacgtggtactgtaatcgttgcgagacct ; Right flanking sequence: actgtttaattttaaaagcgtctataacgt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

his-55-his-57 sgRNA #1: cattatgctattggagtcgg
his-55-his-57 sgRNA #2: cgcttagtaagcatcacatg

Left Flanking Sequence: aaacgtggtactgtaatcgttgcgagacct
Right Flanking Sequence: actgtttaattttaaaagcgtctataacgt

Deletion:  4040 bp

Wildtype DNA File: his-55 to his-57_Wildtype
Insertion DNA File: his-55 to his-57_Insertion
Plasmid: Guides: pMLV-EJ1 (his-55->his-57 sgRNA #1), pMLV-EJ2 (his-55->his-57 sgRNA #2)
Plasmid: Template: pMLV-HA-EJ [his-55 to his-57 repair]

QC:  PPP

his-55 to his-57 deficiency primers:
his-55-57-FGP: gtgcaatgcgatgctgttga
his-55-57-RGP: cgacaatgacaccggaagga
loxPmyo2NeoR-FCP: CTGCATGCGTCGACATAACT
loxPmyo2NeoR-RCP: CGTAGAGCTCGGTACCTCGT

Expected PCR results:
Primer Pair					WT		In/Del
his-55-57-FGP	his-55-57-RGP			5377 bp		6754 bp *
his-55-57-FGP	loxPMyo2NeoR-RCP		-		731 bp
his-55-57-RGP	loxPMyo2NeoR-FCP		-		754 bp
* This PCR product is not expected to be present			

PCR Parameters: (NEB Quick-load 2x Taq Master Mix)
(1) 95C/30 sec
(2) 95C/30 sec
(3) 58C/30 sec
(4) 68C/5:30 min
(5) To step (2) x 34 times
(6) 68C/5:00

